Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0275 chr2L 594183–594824 (641 bp) Gsc, CG13689 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0010323Gscoverlapping BDGP FlyBase iFly
FBgn0031270CG136898630bp upstream BDGP FlyBase
FBgn0263657CR4364811731bp upstream BDGP FlyBase
FBgn0263658CR4364914157bp upstream BDGP FlyBase
FBgn0023489Pph1314635bp downstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

cggcggggaatttgtctctaccatttgtgccagcatagatccagccggagggggcgtaggcggcggggaggggctgggcgtgctcacgacggtgatcttgaacttggccttcgagggcggaatgtcgggcgtggtgctgggagtggtggtggtggtgcctccaccgcctcctccaggggtccacagtgaggagagaatcttgaagaagtctatgaagctttcgagtaggaaaaagtctcttccccactgatttttttttaatgaagcggcacttttgaagcactaagcgctttacaattttttttaattcagtaatggtggcaatgttgcgaatattaagtctaggtttttttcactggattagtgtgttttgatcgatgccaagttcactaaaccgcactagaaacacgcactgcaatcgcgtcgtgattttatattttattatttccacaggttttctgccaccgggaacccttcttgtccgctcgagctgcgaaagtgttgtgagagcgttccgcccgacaagttgtcgattgagtagtcgttaggccagttcctcgacagatatagatacagactctcagatgccagatacaaactcacatctgctctctcgtttagcggacatttttcgacgttggc

PCR verification status

Line verified as correct.

No slide loaded.