| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT0275 | chr2L 594183–594824 (641 bp) | Gsc, CG13689 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0010323 | Gsc | overlapping | BDGP FlyBase iFly |
| FBgn0031270 | CG13689 | 8630bp upstream | BDGP FlyBase |
| FBgn0263657 | CR43648 | 11731bp upstream | BDGP FlyBase |
| FBgn0263658 | CR43649 | 14157bp upstream | BDGP FlyBase |
| FBgn0023489 | Pph13 | 14635bp downstream | BDGP FlyBase iFly |
Sequence
cggcggggaatttgtctctaccatttgtgccagcatagatccagccggagggggcgtaggcggcggggaggggctgggcgtgctcacgacggtgatcttgaacttggccttcgagggcggaatgtcgggcgtggtgctgggagtggtggtggtggtgcctccaccgcctcctccaggggtccacagtgaggagagaatcttgaagaagtctatgaagctttcgagtaggaaaaagtctcttccccactgatttttttttaatgaagcggcacttttgaagcactaagcgctttacaattttttttaattcagtaatggtggcaatgttgcgaatattaagtctaggtttttttcactggattagtgtgttttgatcgatgccaagttcactaaaccgcactagaaacacgcactgcaatcgcgtcgtgattttatattttattatttccacaggttttctgccaccgggaacccttcttgtccgctcgagctgcgaaagtgttgtgagagcgttccgcccgacaagttgtcgattgagtagtcgttaggccagttcctcgacagatatagatacagactctcagatgccagatacaaactcacatctgctctctcgtttagcggacatttttcgacgttggc
PCR verification status
Line verified as correct.
No slide loaded.