ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT0275 | chr2L 594183–594824 (641 bp) | Gsc, CG13689 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0010323 | Gsc | overlapping | BDGP FlyBase iFly |
FBgn0031270 | CG13689 | 8630bp upstream | BDGP FlyBase |
FBgn0263657 | CR43648 | 11731bp upstream | BDGP FlyBase |
FBgn0263658 | CR43649 | 14157bp upstream | BDGP FlyBase |
FBgn0023489 | Pph13 | 14635bp downstream | BDGP FlyBase iFly |
Sequence
cggcggggaatttgtctctaccatttgtgccagcatagatccagccggagggggcgtaggcggcggggaggggctgggcgtgctcacgacggtgatcttgaacttggccttcgagggcggaatgtcgggcgtggtgctgggagtggtggtggtggtgcctccaccgcctcctccaggggtccacagtgaggagagaatcttgaagaagtctatgaagctttcgagtaggaaaaagtctcttccccactgatttttttttaatgaagcggcacttttgaagcactaagcgctttacaattttttttaattcagtaatggtggcaatgttgcgaatattaagtctaggtttttttcactggattagtgtgttttgatcgatgccaagttcactaaaccgcactagaaacacgcactgcaatcgcgtcgtgattttatattttattatttccacaggttttctgccaccgggaacccttcttgtccgctcgagctgcgaaagtgttgtgagagcgttccgcccgacaagttgtcgattgagtagtcgttaggccagttcctcgacagatatagatacagactctcagatgccagatacaaactcacatctgctctctcgtttagcggacatttttcgacgttggc
PCR verification status
Line verified as correct.
No slide loaded.