ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT0868 | chr2L 1731722–1732292 (570 bp) | CG17652, CG31937 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0031361 | CG17652 | overlapping | BDGP FlyBase |
FBgn0031360 | CG31937 | 653bp downstream | BDGP FlyBase |
FBgn0264494 | CG17646 | 802bp upstream | BDGP FlyBase |
FBgn0000579 | Eno | 2087bp downstream | BDGP FlyBase |
FBgn0260648 | Rrp40 | 2148bp downstream | BDGP FlyBase |
Sequence
ttgtgcagatagagcagacaacgtccgggaatcttgcgaagactctcctgcagcagacgatcttgcgaggcaaccacatagcgattgtctttggtctgaaaggcaagtaatcattttatggctatagcatacttgaaatcaagtaactctcaatttaccatcgatttgatgcattcggaagcggggactggttttccttcgtgtccgcatttgtggacatggaatcgcttgacgatggatgtggctccagtgagaggagcacccagggattccgactccagaataacacactgggtggtcagtagcttaacgccgcactggaagtactttttaatctgctcatctatgccaatcttttgctaaaagtaaaaattaactatggatatcaacaagtgctagagatgatataagcaataacccacctgaagggctgcttggcaaaaggtggcatcaattagcacttggtagggttcccggtagtcgaaattgctggcaaaaaacaccagagttttgtgcgacttcttaaaacgagatattttcatgatatttgcgggtgggtagtcaccaagtt
PCR verification status
Line verified as correct.
No slide loaded.