ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT10275 | chr2L 20075435–20075799 (364 bp) | pr, neb |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0003141 | pr | overlapping | BDGP FlyBase |
FBgn0004374 | neb | 322bp upstream | BDGP FlyBase |
FBgn0045064 | bwa | 1717bp downstream | BDGP FlyBase |
FBgn0032843 | CG10730 | 3241bp downstream | BDGP FlyBase |
FBgn0263773 | fok | 3835bp upstream | BDGP FlyBase |
Sequence
tcaacagctgctcccgataacaaggcagcgcgtatcggttatcggccagagctgagcagtttgccgccacaactgttctcagtgatttacaactgcacaaatagactattgtatgggtagaaatccttacactattacaatttcgctatatatttatttatttcatgttagttctttgtcaattatctcataatttaaatgagctgattaacagagttagctaacagagtatgtaagtgctgttcatccctggctcgtggtggcgttgccggacctcacgccgctcactgtaatcaaccctgctttgctatcgatcgccgcccttcactagaaaaaaaataacaaacgacgccgcgcaataattc
PCR verification status
Line verified as correct.
No slide loaded.