ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT13871 | chr2R 4932175–4932522 (347 bp) | proPO45, CG13743 |
active |
crystal cell, procrystal cell | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | procrystal cell | 2 |
13-14 | crystal cell | 4 |
15-16 | crystal cell | 4 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0033367 | proPO45 | overlapping | BDGP FlyBase |
FBgn0033368 | CG13743 | 180bp upstream | BDGP FlyBase |
FBgn0033366 | Ance-4 | 2529bp downstream | BDGP FlyBase |
FBgn0033365 | CG8170 | 13626bp downstream | BDGP FlyBase |
FBgn0033369 | CG8197 | 15791bp upstream | BDGP FlyBase |
Sequence
tggggaatgtgactggaagtctgggaacttcacgactgtgactattcaccgaaagaactgcacattttatacaaaacttcgaaggcactagtatcggttttgaaaaccacaagaacgcctgagaattgaaattgtcgacaaattgcggcgataaggatatagtatggaaaccgcagtgttgttttagcatatttctaaaatgcagttttattatttcaagagtatttcatttggttttgctttagcttatctatacatatatactattggaatgaaatcggattttgttatctctgggatatgcctgcgttgtaaatcaaaacttctctacgcacacgatcctccggt
PCR verification status
Line verified as correct.
No slide loaded.