ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT14428 | chr2R 5987049–5987233 (184 bp) | RpLP0-like, 14-3-3zeta |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0033485 | RpLP0-like | overlapping | BDGP FlyBase |
FBgn0004907 | 14-3-3zeta | 133bp upstream | BDGP FlyBase iFly |
FBgn0001291 | Jra | 989bp downstream | BDGP FlyBase iFly |
FBgn0033484 | CG2269 | 3129bp downstream | BDGP FlyBase |
FBgn0003071 | Pfk | 10196bp upstream | BDGP FlyBase |
Sequence
gaacgtaaacacgtgcggccttctagagatggtaaatgttcctaaccaacaatcgatagctctatcgtgtatcggaatttcgcaccgtgcgggttggaaaattcctgcgggccaatccctacttcagctttcctcgttttccaacacatctgcgcgtagagaagaagaagaaccttcacgtccga
PCR verification status
Line verified as correct.
No slide loaded.