Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14428 chr2R 5987049–5987233 (184 bp) RpLP0-like, 14-3-3zeta activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0033485RpLP0-likeoverlapping BDGP FlyBase
FBgn000490714-3-3zeta133bp upstream BDGP FlyBase iFly
FBgn0001291Jra989bp downstream BDGP FlyBase iFly
FBgn0033484CG22693129bp downstream BDGP FlyBase
FBgn0003071Pfk10196bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gaacgtaaacacgtgcggccttctagagatggtaaatgttcctaaccaacaatcgatagctctatcgtgtatcggaatttcgcaccgtgcgggttggaaaattcctgcgggccaatccctacttcagctttcctcgttttccaacacatctgcgcgtagagaagaagaagaaccttcacgtccga

PCR verification status

Line verified as correct.

No slide loaded.