ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT16245 | chr2R 9480792–9481191 (399 bp) | CG6191, CG6197 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0027581 | CG6191 | overlapping | BDGP FlyBase |
FBgn0033859 | CG6197 | 357bp upstream | BDGP FlyBase |
FBgn0033860 | S-Lap5 | 3390bp upstream | BDGP FlyBase |
FBgn0262360 | CG43058 | 7358bp upstream | BDGP FlyBase |
FBgn0085265 | CG34236 | 11287bp upstream | BDGP FlyBase |
Sequence
cagcagcgacgaaaacatctgcagatgggcttacgaaaaattcacaaactgaggccagtgttgggcagcggacgaagggcgaaataccaattcaaagggaggcaaaatataccgcaatggtactctagaaaattcacgattgttttggtttgtccataacttcaacgtttaaataaggtgcacttagaaaattctagatgttcacaatttgtaaaaaaaatgtacacaagccaaagttatcttagttttatgaacaatttttctgtattcttaaaatattgtttacatgttaattaggatttaattactttggtattagctgcggtatcttaataccactacttttcaaaccttctggcaacgccatttcgatcagctgttttcgtgggacgcgcatgag
PCR verification status
Line verified as correct.
No slide loaded.