Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT18379 chr2R 13637620–13637835 (215 bp) CG10931, CG5002 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0034274CG10931overlapping BDGP FlyBase
FBgn0034275CG5002178bp upstream BDGP FlyBase
FBgn0003545sub2038bp downstream BDGP FlyBase iFly
FBgn0034276CG63853440bp upstream BDGP FlyBase
FBgn0034272Ir54a4111bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

taagccggccatgtcattagccaaatattaaggttgtctttgtaattgtttatcaacggactaacagagcgaacatgatatggcggcaccggtacctgcgcttgtaaatcttatatggccagaatgtgcgaacgcgattgctttcggtctctaaagccgttggacgacggcgatcggagcggcagtcgcgtttggagcagcacactgagcggacgc

PCR verification status

Line verified as correct.

No slide loaded.