ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT18379 | chr2R 13637620–13637835 (215 bp) | CG10931, CG5002 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0034274 | CG10931 | overlapping | BDGP FlyBase |
FBgn0034275 | CG5002 | 178bp upstream | BDGP FlyBase |
FBgn0003545 | sub | 2038bp downstream | BDGP FlyBase iFly |
FBgn0034276 | CG6385 | 3440bp upstream | BDGP FlyBase |
FBgn0034272 | Ir54a | 4111bp downstream | BDGP FlyBase |
Sequence
taagccggccatgtcattagccaaatattaaggttgtctttgtaattgtttatcaacggactaacagagcgaacatgatatggcggcaccggtacctgcgcttgtaaatcttatatggccagaatgtgcgaacgcgattgctttcggtctctaaagccgttggacgacggcgatcggagcggcagtcgcgtttggagcagcacactgagcggacgc
PCR verification status
Line verified as correct.
No slide loaded.