Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT19242 chr2R 15312405–15312605 (200 bp) hts, CalpA activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0263391htsoverlapping BDGP FlyBase
FBgn0012051CalpA213bp upstream BDGP FlyBase
FBgn0020440Fak5759bp upstream BDGP FlyBase iFly
FBgn0050326tRNA:CR303269558bp downstream BDGP FlyBase
FBgn0050225tRNA:CR302259984bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ttagggatggacaaacctgacgcatgtcaatgggtcgatatttgtttgaaatatcgatgctcttatcgaaatatttttcagtaaaatcgggcgattatcgatatatttacattgaaatagggctggcaaatcacaaatttcggcaaaatacttcgataaaaataaataccaaaacattcgatagcagtcaggtgttgagct

PCR verification status

Line verified as correct.

No slide loaded.