ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT19242 | chr2R 15312405–15312605 (200 bp) | hts, CalpA |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0263391 | hts | overlapping | BDGP FlyBase |
FBgn0012051 | CalpA | 213bp upstream | BDGP FlyBase |
FBgn0020440 | Fak | 5759bp upstream | BDGP FlyBase iFly |
FBgn0050326 | tRNA:CR30326 | 9558bp downstream | BDGP FlyBase |
FBgn0050225 | tRNA:CR30225 | 9984bp downstream | BDGP FlyBase |
Sequence
ttagggatggacaaacctgacgcatgtcaatgggtcgatatttgtttgaaatatcgatgctcttatcgaaatatttttcagtaaaatcgggcgattatcgatatatttacattgaaatagggctggcaaatcacaaatttcggcaaaatacttcgataaaaataaataccaaaacattcgatagcagtcaggtgttgagct
PCR verification status
Line verified as correct.
No slide loaded.