ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT19652 | chr2R 16132881–16133418 (537 bp) | CG11208, ppk6 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0034488 | CG11208 | overlapping | BDGP FlyBase |
FBgn0034489 | ppk6 | 384bp upstream | BDGP FlyBase |
FBgn0034487 | Efhc1.2 | 2504bp downstream | BDGP FlyBase |
FBgn0034490 | CG9864 | 2754bp upstream | BDGP FlyBase |
FBgn0034486 | CG13869 | 5948bp downstream | BDGP FlyBase |
Sequence
tcgatgcattggtatcgatgatttcctaccccccgcacagcgattgttgtggctatcgatgcgcacagtcagtgtatacttatgcgatagtcattgaaaggaaacatacttttaattatgcgagcaaattctgaaaggtaactgcaaagctcgaatcatttcgtcagaaagataaaatgccagtgatttttttaacattgctgatatttgaaacactctcatctctactaaccccatataccaaacgtgtgtaaaaatcagttgtgaaagaataccaacattgacataccagctcgttatcgatgcgacagcccttttatcgataatttctaatttcccgcctatgttcgaaattttttctaagataccataatttctttttttttgtatttgctttattgccatgcctttctgggttgctgaaccttctgcagttgatagtttatgtataagcgatatgtgcaatagtaaaagaactcaactactgaaatcatacttagtccgaggcagaggttaaagatgccacccaaatccgctg
PCR verification status
Line verified as correct.
No slide loaded.