| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT20804 | chr2R 18295742–18296194 (452 bp) | CG6044, ventrally-expressed-protein-D |
active |
head mesoderm anlage, trunk mesoderm anlage broad, trunk mesoderm AISN broad | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | trunk mesoderm AISN broad | 3 |
| 4-6 | head mesoderm AISN | 3 |
| 7-8 | head mesoderm anlage | 4 |
| 7-8 | trunk mesoderm anlage broad | 4 |
| 9-10 | brain anlage subset | 3 |
| 9-10 | ventral nerve cord anlage subset | 3 |
| 9-10 | trunk mesoderm anlage | 2 |
| 11-12 | brain primordium subset | 3 |
| 11-12 | ventral nerve cord primordium subset | 3 |
| 13-14 | brain broad | 2 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0034725 | CG6044 | overlapping | BDGP FlyBase |
| FBgn0053200 | ventrally-expressed-protein-D | 288bp upstream | BDGP FlyBase |
| FBgn0022984 | qkr58E-3 | 971bp upstream | BDGP FlyBase |
| FBgn0034726 | Mes4 | 3552bp upstream | BDGP FlyBase |
| FBgn0022986 | qkr58E-1 | 4319bp upstream | BDGP FlyBase |
Sequence
gtggcttaccgaatcattgtgaaggaaactatatatatgtgaacagattatgagtacataaaaacaatgtatgcaattttgtcgaatgtaaaactgaaataaactagagctgctaaagacccagctgaatccattcaacgaaatccacccctatatagctacacacacacatgcagaccggcaggattcggtggcttgctttccgagagtggcaggggataaacacacgcgcgaccaggacaacaacaaagcgctgaggtccttgtaggagctcactgcagctgcaacgcggcgcaagagtgggaggaggaattccgcaacgtgcgcagggcctggcaaccatatggtggcttctaagggtggtacttatggtggtggcacaagcctcaagcgactacttcgccttccggatcagttgtcaactgcatagcggccaggacacacatctagtca
PCR verification status
Line verified as correct.
No slide loaded.