| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT21852 | chr2R 20290480–20291100 (620 bp) | Rpn8, slik |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0002787 | Rpn8 | overlapping | BDGP FlyBase |
| FBgn0035001 | slik | 278bp downstream | BDGP FlyBase |
| FBgn0010414 | SerT | 1638bp upstream | BDGP FlyBase |
| FBgn0035002 | CG3419 | 8934bp upstream | BDGP FlyBase |
| FBgn0266048 | CR44813 | 10981bp downstream | BDGP FlyBase |
Sequence
gcatgcttttgcttgccttgaaataaattcagaaagcgaggcgtcggccacactgtaaatcgtttctgcttgtcattttggcctgagttttttgccgcaaattgcaggtaatttagcgaaaaacaggagtcgcaggaagccaaacccgtcgaaaacaaatcagtccggtacctatcaatcggcgcagaggtcatagtaagcccccgaaccgaaaacccagaaaaagcacaaacatgccgtcgcaggaggtgagcgtaaacaaagtgatagtgcatccattggttctgctgtccgtggtggatcacttcaaccggatgggaaagattggcaaccagaagcgcgtagtgggagtccttctgggctgctggcgatccaagggagtgctcgatgtgtccaacagcttcgcaggttagtactgcctttgaatatccaaagtcgtggccataaaacaaaagaattccctcccgacttccagtgcccttcgacgaggatgacaaggacaagtcggtgtggttcctggaccacgactacctggagaatatgtacggcatgttcaaaaaggtgaacgccagggaacgggttgtgggatggtatcacacaggtcccaagctccaccaaaac
PCR verification status
Line verified as correct.
No slide loaded.