| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT24044 | chr3L 1502563–1502875 (312 bp) | pUf68, Psa |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0028577 | pUf68 | overlapping | BDGP FlyBase iFly |
| FBgn0261243 | Psa | 280bp upstream | BDGP FlyBase |
| FBgn0011204 | cue | 663bp upstream | BDGP FlyBase |
| FBgn0263471 | scaRNA:pUf68-a | 3566bp downstream | BDGP FlyBase |
| FBgn0043458 | CG12084 | 5921bp downstream | BDGP FlyBase |
Sequence
tggatacgaactagtggtggcacttcgcgtcgattgcctcactcttcgattattcgatagtaaagttgagttatctggctactctaatagccgataggttttgagtaactgtggggaaattgtcattttaaaatgtaatctcgataaattacgatcggttataaactttttagctggctgtgcaagcaattccacactgtcaatcgaaaaatccccgagttaagcgcaagcgaaactcagcccgaaatagattagtttggctaacctagtgaagttcatagttcagaagatgcaaagcagtgtatgtatagtg
PCR verification status
Line verified as correct.
No slide loaded.