ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT24044 | chr3L 1502563–1502875 (312 bp) | pUf68, Psa |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0028577 | pUf68 | overlapping | BDGP FlyBase iFly |
FBgn0261243 | Psa | 280bp upstream | BDGP FlyBase |
FBgn0011204 | cue | 663bp upstream | BDGP FlyBase |
FBgn0263471 | scaRNA:pUf68-a | 3566bp downstream | BDGP FlyBase |
FBgn0043458 | CG12084 | 5921bp downstream | BDGP FlyBase |
Sequence
tggatacgaactagtggtggcacttcgcgtcgattgcctcactcttcgattattcgatagtaaagttgagttatctggctactctaatagccgataggttttgagtaactgtggggaaattgtcattttaaaatgtaatctcgataaattacgatcggttataaactttttagctggctgtgcaagcaattccacactgtcaatcgaaaaatccccgagttaagcgcaagcgaaactcagcccgaaatagattagtttggctaacctagtgaagttcatagttcagaagatgcaaagcagtgtatgtatagtg
PCR verification status
Line verified as correct.
No slide loaded.