ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT24057 | chr3L 1536790–1537178 (388 bp) | CG12091, CG7852 |
active |
brain broad, ventral nerve cord broad |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | brain broad | 1 |
13-14 | ventral nerve cord broad | 1 |
15-16 | brain broad | 2 |
15-16 | ventral nerve cord broad | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0035228 | CG12091 | overlapping | BDGP FlyBase |
FBgn0035229 | CG7852 | 347bp upstream | BDGP FlyBase |
FBgn0035227 | CG12090 | 2757bp downstream | BDGP FlyBase |
FBgn0053971 | Ir62a | 5532bp downstream | BDGP FlyBase |
FBgn0052313 | CG32313 | 8038bp upstream | BDGP FlyBase |
Sequence
tgatacactttttctcgtcaggtcgcgatccggttcagaactggttcggtgctggttccccaccccaactctccgctcctgaacgggttccgaaaccatatacaccctattgtagtagtgttattttcggaaccagtacaactcgtttatatacaccaacggtatatataacaaaaagggtggtaaaatatgcagctttacttattgctcaagttttaaaaaacaaacatatttttcgatgcaattgtttttcgcaagtatttttctgctggtattttaaagaaacccccttatgcttttagttgaattattataacggtcattttcttttggtttactcctacttacacagcctggtcatactggcgaccaaagtagtttgtttttgc
PCR verification status
Line verified as correct.
No slide loaded.