ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT26651 | chr3L 6625997–6626636 (639 bp) | GluRIA, CG8398 |
active |
anterior endoderm anlage, head mesoderm anlage, brain broad | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | anterior endoderm anlage | 3 |
7-8 | head mesoderm anlage | 3 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | brain broad | 1 |
13-14 | ventral nerve cord broad | 1 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0004619 | GluRIA | overlapping | BDGP FlyBase |
FBgn0035708 | CG8398 | 13785bp downstream | BDGP FlyBase |
FBgn0035707 | CG8368 | 24159bp downstream | BDGP FlyBase |
FBgn0024177 | zpg | 26866bp downstream | BDGP FlyBase iFly |
FBgn0002926 | ndl | 29532bp downstream | BDGP FlyBase iFly |
Sequence
gggatactgcaaggatttggccgatatgctagcagctcaactgggaattaaatgtgagttcaaaagcaaatcgttaaattacaaaagggggaggaaagctatattcatagatagcttacttattagaagtacttccaaagattatgtggtaatttaaataaccaatccattcccagatgaaatacgcctggtgcaagatggcaactatggtgcagagaatcagtatgctcctggcggttgggatggcatggtgggtgagctgattcgcaaggaggcggatatagccatatccgcaatgactattacagccgaaagagaacgggttatagactttagcaaaccctttatgaccctgggaatatccattatgataaagaagcccgtgaaacagacaccaggagtgtttagttttcttaatcccctatcccaggaaatttgggtaagtcttgggctgagaatttcttcttattttcttatcataatgcaatgataacaatttccagataagcgtgattctcagctatgtgggtgttagttttgttctgtactttgttacacgtttcccaccctatgagtggcggattgtgaggcgtcctcaagcggattccactgcccagcaaccaccgggaattattggagg
PCR verification status
Line verified as correct.
No slide loaded.