| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT28267 | chr3L 9797330–9797598 (268 bp) | CG32052, Ilp4 |
      active |
mesoderm AISN | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | mesoderm AISN | 4 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0044328 | CG32052 | overlapping | BDGP FlyBase |
| FBgn0044049 | Ilp4 | overlapping | BDGP FlyBase |
| FBgn0044050 | Ilp3 | 2111bp downstream | BDGP FlyBase |
| FBgn0036046 | Ilp2 | 3791bp downstream | BDGP FlyBase iFly |
| FBgn0044051 | Ilp1 | 5333bp downstream | BDGP FlyBase |
UCSC snapshot
Sequence
tcgctgggcatgccaaatgatactgatccttggagttggccggcgctcaaaatgttgactcgctaattgactttttgacttcacgtattgcgaccaggtagaaagttaaattcgggccaggtcagtcaaccaaccaaacagtcagctgcaggagatttccatttgaactaccaggtttttcttatttttgtcgctcgaccagccggcgggaaaatgccccgcgaaaggaaatggcctttcccggccaggaattgcccgacttaaccaaa
PCR verification status
Line verified as correct.
No slide loaded.