| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT3065 | chr2L 6070568–6071026 (458 bp) | CG9154, Kr-h2 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0031777 | CG9154 | overlapping | BDGP FlyBase |
| FBgn0028419 | Kr-h2 | 422bp upstream | BDGP FlyBase |
| FBgn0031776 | CG13993 | 731bp downstream | BDGP FlyBase |
| FBgn0031775 | CG9150 | 1975bp downstream | BDGP FlyBase |
| FBgn0031774 | CG9147 | 2934bp downstream | BDGP FlyBase |
Sequence
gcagcgagatgtcgtcgtccataattaattatttgccactaaatgaatcttagagcattcaaatcaaaataaaccaaaatgtgcgtttgaagattagaggtgcgaaattagcgatacaaatgagaacttattggggggattccaggccttggcgctgttttcaaattgtaaattattagaaacttaggccaactgcgatattgaaattatactttcaaaataatatgcactttaaccgtatgcaaatcgattaccaattttaatttattttaagttattttattaatacaactagctccagaaacctgtatcgtaacttttatttgacaacacattttcaaactgtactgaatatttaggcgtttaatcgacaactaaaacagcaactttcaagtacgtggtctttaaatttcgtaagatcgagaaagcagtgcgatacaaatcggtggcagccctgtg
PCR verification status
Line was not verified.
No slide loaded.