ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT3065 | chr2L 6070568–6071026 (458 bp) | CG9154, Kr-h2 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0031777 | CG9154 | overlapping | BDGP FlyBase |
FBgn0028419 | Kr-h2 | 422bp upstream | BDGP FlyBase |
FBgn0031776 | CG13993 | 731bp downstream | BDGP FlyBase |
FBgn0031775 | CG9150 | 1975bp downstream | BDGP FlyBase |
FBgn0031774 | CG9147 | 2934bp downstream | BDGP FlyBase |
Sequence
gcagcgagatgtcgtcgtccataattaattatttgccactaaatgaatcttagagcattcaaatcaaaataaaccaaaatgtgcgtttgaagattagaggtgcgaaattagcgatacaaatgagaacttattggggggattccaggccttggcgctgttttcaaattgtaaattattagaaacttaggccaactgcgatattgaaattatactttcaaaataatatgcactttaaccgtatgcaaatcgattaccaattttaatttattttaagttattttattaatacaactagctccagaaacctgtatcgtaacttttatttgacaacacattttcaaactgtactgaatatttaggcgtttaatcgacaactaaaacagcaactttcaagtacgtggtctttaaatttcgtaagatcgagaaagcagtgcgatacaaatcggtggcagccctgtg
PCR verification status
Line was not verified.
No slide loaded.