ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT3273 | chr2L 6498347–6498684 (337 bp) | CG9550, CG31637 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0031826 | CG9550 | overlapping | BDGP FlyBase |
FBgn0051637 | CG31637 | 300bp upstream | BDGP FlyBase |
FBgn0051638 | CG31638 | 1360bp downstream | BDGP FlyBase |
FBgn0031824 | CG9547 | 3816bp downstream | BDGP FlyBase |
FBgn0031822 | CG9548 | 7505bp downstream | BDGP FlyBase |
Sequence
gggcaaatgttaggggtgtagtgggccaggggtttgatatgaaagctttatttaaggtatatttcgaggggttaaatatgtaaatttgatctatgctcatcagaacttttaaatgcttttaaaaaaatgtttttgaatctgaattaaaactctccgaattggttcgagtctgtgctacatggccagccaggtttcacaccaaatgtagtgactagtacactgtgacttcatggaatatttaggatatagttgttatacgcgacttcactgctcgccgcggcatctttccacctgcccgcaacggtcactttgttgttgtcaatcgtttcgttcgcatc
PCR verification status
Line verified as correct.
No slide loaded.