ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT32915 | chr3L 18666253–18666629 (376 bp) | Capr, GNBP2 |
![]() ![]() ![]() ![]() ![]() ![]() active |
brain broad, ventral nerve cord broad | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | brain broad | 2 |
15-16 | ventral nerve cord broad | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0042134 | Capr | overlapping | BDGP FlyBase |
FBgn0040322 | GNBP2 | 321bp upstream | BDGP FlyBase |
FBgn0040323 | GNBP1 | 2647bp upstream | BDGP FlyBase |
FBgn0260027 | CG42495 | 5019bp downstream | BDGP FlyBase |
FBgn0036801 | MYPT-75D | 5977bp downstream | BDGP FlyBase |
Sequence
ctagagctggctttcgggccgatgtgcgttcgatagtatcgatgccgcttgggctagcagttcgatacgatgcacattgccgctgccggcgacaatcgattgcagtgtgcgatatggaaaatgtggtaaggagttgcaaatgtttttcgtgtaaattttcaattcgttcactttttacactgtgagattgtgaaggaaataagttaattctgaaaagcatttacttgttaacaacttttgcagtaagaacacaattcctggtatcgataatcgatatgtctttcgactttagaaacattttttgaatatgaagcgatgattgatgtttaagtactttatttatattttggtgacaaatgccacagctactccgcata
PCR verification status
Line verified as correct.
No slide loaded.