ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT33397 | chr3L 19594724–19595245 (521 bp) | CG9368, Taf6 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0036890 | CG9368 | 9bp upstream | BDGP FlyBase |
FBgn0010417 | Taf6 | 243bp downstream | BDGP FlyBase |
FBgn0020277 | lush | 2774bp upstream | BDGP FlyBase iFly |
FBgn0005386 | ash1 | 2870bp downstream | BDGP FlyBase iFly |
FBgn0036891 | CG9372 | 4584bp upstream | BDGP FlyBase |
Sequence
atttctccagcgcattgctgggtgaacgcacaaagagctctgctcagcactccttgtagatacccatcgcaggacaaaggcaaagctcgaaacgcttctggcagcattttcaaaggataaaaaggaattctcacaaaaacccaggaaagatgcatgccagatttgcggatcccgagccagcgtctccggacagcgttgatggaatcgaaacggagtcactggaggcgcggattgaggccttcaagcaaaatccccagaacatggccgcgttgcgggaggcgctcgacgatgtgctcctgcgggctgagacggaggcgaacaggcgggcagttgagagccagaaatcgcaacaggttgaccacacatatctaatattcgttttcgagctaactgaactaacttgtaacttcccttgcagggcaaggaaaaacgaccgagtaagtatacgcagtgtggttcagtacatttcacttcttagctatttggatagtgtattgcttttccctttcgagcacttcagcg
PCR verification status
Line verified as correct.
No slide loaded.