Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT33397 chr3L 19594724–19595245 (521 bp) CG9368, Taf6 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0036890CG93689bp upstream BDGP FlyBase
FBgn0010417Taf6243bp downstream BDGP FlyBase
FBgn0020277lush2774bp upstream BDGP FlyBase iFly
FBgn0005386ash12870bp downstream BDGP FlyBase iFly
FBgn0036891CG93724584bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

atttctccagcgcattgctgggtgaacgcacaaagagctctgctcagcactccttgtagatacccatcgcaggacaaaggcaaagctcgaaacgcttctggcagcattttcaaaggataaaaaggaattctcacaaaaacccaggaaagatgcatgccagatttgcggatcccgagccagcgtctccggacagcgttgatggaatcgaaacggagtcactggaggcgcggattgaggccttcaagcaaaatccccagaacatggccgcgttgcgggaggcgctcgacgatgtgctcctgcgggctgagacggaggcgaacaggcgggcagttgagagccagaaatcgcaacaggttgaccacacatatctaatattcgttttcgagctaactgaactaacttgtaacttcccttgcagggcaaggaaaaacgaccgagtaagtatacgcagtgtggttcagtacatttcacttcttagctatttggatagtgtattgcttttccctttcgagcacttcagcg

PCR verification status

Line verified as correct.

No slide loaded.