ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT33650 | chr3L 20096322–20096900 (578 bp) | CG14186, CR44679 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0036935 | CG14186 | overlapping | BDGP FlyBase |
FBgn0265890 | CR44679 | 1281bp upstream | BDGP FlyBase |
FBgn0036936 | CG14185 | 2872bp upstream | BDGP FlyBase |
FBgn0036937 | Ir76b | 5262bp upstream | BDGP FlyBase |
FBgn0036938 | CG14187 | 9043bp upstream | BDGP FlyBase |
Sequence
agtccaaggcctctgcccgctcgggcgtggtgggcgttggagctgccgctcccgtagccaccgcctcccgttccaggcgccgctgtcgcgcctccgtgcgacgatgccgttgatgctggcggtgcacctttgcctccatttggacttgtgggatgctagatccgatccgagccgagttgagccactaggccagctgcataacaggtggacaccccctgggaacgggcacggaaacgggaatgggagtgggaactttgtgctgctgcagcttttgacccaaataacacagtgcacacccacacacacacacacacaaccgcgagaggacacgaccacaacgacaatcagcgaatgcagctcagctgcgagctggtggcatttcctcaaggctccacttcagcgcactctgcacatacggatatcattggcgaccgaataactgatcacttatcggatagatcaatctctttgttacggtactgcgttcgatttttactcgattactgcgttatccgtgcattgttcttatattccttaaaaaaatattcacgaggcgaacggaaccgaaaccaaagcacc
PCR verification status
Line verified as correct.
No slide loaded.