| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT34271 | chr3L 21347996–21348413 (417 bp) | CG32436, CG12971 |
active |
leading edge cell specific anlage, leading edge cell | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | leading edge cell specific anlage | 2 |
| 13-14 | leading edge cell | 2 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0052436 | CG32436 | overlapping | BDGP FlyBase |
| FBgn0037078 | CG12971 | 204bp upstream | BDGP FlyBase |
| FBgn0052437 | CG32437 | 2787bp upstream | BDGP FlyBase |
| FBgn0052440 | CG32440 | 5283bp upstream | BDGP FlyBase |
| FBgn0037076 | ebd2 | 5609bp downstream | BDGP FlyBase |
Sequence
gaagaggaggagggtggcgaagagggtggtgcttgacgggatttagcagaaagagtcgcttggtatttgttggctatggagctctaaattcttttttacttattgtttggataaaatttatggaagcattaataaagtatataatctcttttttaatttgatagttttattagtcccaaagataaattaaaacagagatagaaaatacaaacgcttcagatgtgactaatataattcagacaggattatctaaagcatagtcgtcttcaaattcgaaatttaatatgctctttaagaactaagataaacatttaacaacaatcggatgacgcatcgtccgatgattcgatgtcgtcattgggtgactcgattttgagtgactcaatgccgcagacgacgctgttcctcggcttgttta
PCR verification status
Line was not verified.
No slide loaded.