ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT34271 | chr3L 21347996–21348413 (417 bp) | CG32436, CG12971 |
![]() ![]() ![]() ![]() ![]() ![]() active |
leading edge cell specific anlage, leading edge cell | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | leading edge cell specific anlage | 2 |
13-14 | leading edge cell | 2 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0052436 | CG32436 | overlapping | BDGP FlyBase |
FBgn0037078 | CG12971 | 204bp upstream | BDGP FlyBase |
FBgn0052437 | CG32437 | 2787bp upstream | BDGP FlyBase |
FBgn0052440 | CG32440 | 5283bp upstream | BDGP FlyBase |
FBgn0037076 | ebd2 | 5609bp downstream | BDGP FlyBase |
Sequence
gaagaggaggagggtggcgaagagggtggtgcttgacgggatttagcagaaagagtcgcttggtatttgttggctatggagctctaaattcttttttacttattgtttggataaaatttatggaagcattaataaagtatataatctcttttttaatttgatagttttattagtcccaaagataaattaaaacagagatagaaaatacaaacgcttcagatgtgactaatataattcagacaggattatctaaagcatagtcgtcttcaaattcgaaatttaatatgctctttaagaactaagataaacatttaacaacaatcggatgacgcatcgtccgatgattcgatgtcgtcattgggtgactcgattttgagtgactcaatgccgcagacgacgctgttcctcggcttgttta
PCR verification status
Line was not verified.
No slide loaded.