Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT35032 chr3L 22857460–22857744 (284 bp) CG33169, CG33170 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0053169CG33169overlapping BDGP FlyBase
FBgn0053170CG33170240bp upstream BDGP FlyBase
FBgn0037197CG132392871bp downstream BDGP FlyBase
FBgn0037199CG111373128bp upstream BDGP FlyBase
FBgn0010348Arf79F4019bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tccgaattacggtcgttggtggtagtgttgaaaaccgtctagcgctttggcggttgattaaaaaagggcactaggaaacggtaaaaaccgtagcagaggcacttcaatatgtaaatatgtgcatatgtatattagagaaggcggcatccaccaacatgttttatttttggccgttttgcgttcagtttttaattgcgattgcccttgtttcagtttcacttacgcccgtccaccgaggagctcgtcgtcggtgaccgcaaactaataattgttaatacatatgca

PCR verification status

Line verified as correct.

No slide loaded.