ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT35032 | chr3L 22857460–22857744 (284 bp) | CG33169, CG33170 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0053169 | CG33169 | overlapping | BDGP FlyBase |
FBgn0053170 | CG33170 | 240bp upstream | BDGP FlyBase |
FBgn0037197 | CG13239 | 2871bp downstream | BDGP FlyBase |
FBgn0037199 | CG11137 | 3128bp upstream | BDGP FlyBase |
FBgn0010348 | Arf79F | 4019bp upstream | BDGP FlyBase |
Sequence
tccgaattacggtcgttggtggtagtgttgaaaaccgtctagcgctttggcggttgattaaaaaagggcactaggaaacggtaaaaaccgtagcagaggcacttcaatatgtaaatatgtgcatatgtatattagagaaggcggcatccaccaacatgttttatttttggccgttttgcgttcagtttttaattgcgattgcccttgtttcagtttcacttacgcccgtccaccgaggagctcgtcgtcggtgaccgcaaactaataattgttaatacatatgca
PCR verification status
Line verified as correct.
No slide loaded.