| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT37210 | chr3R 2010335–2010783 (448 bp) | CG31562, NPFR |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0051562 | CG31562 | overlapping | BDGP FlyBase |
| FBgn0037408 | NPFR | 2702bp upstream | BDGP FlyBase |
| FBgn0037406 | Osi1 | 9643bp downstream | BDGP FlyBase |
| FBgn0037409 | Osi24 | 14198bp upstream | BDGP FlyBase |
| FBgn0037405 | CG1077 | 14305bp downstream | BDGP FlyBase |
Sequence
tgagcatggagatggcaaaagcagtcgtacatcctaaatcaggcagtttcttcagatactccacaggcgaaaatattcgctgagtatatttatacaacagggaattggatatgtacgacattttcctgcccaaaatgtcaaagattttccaagaggctgctttcaacgataagctgatggcggaagccatagtcgttggtcgggaacgcaccatcatgatcctcgaggatctggctcctctgcgctacacgaacgcagacagggtgaagcaactggacatggcacataccaagctcgtcctggatatgatggcaaagtttcactctgcagccattatcctgaatcaacgggagccgaaactcttcagtcggaactactcttcgcacttcttctcaaggggcaaaaatgtttgttggttgttaagaccaagccgaatctgaagagtcgct
PCR verification status
Line verified as correct.
No slide loaded.