ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT37210 | chr3R 2010335–2010783 (448 bp) | CG31562, NPFR |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0051562 | CG31562 | overlapping | BDGP FlyBase |
FBgn0037408 | NPFR | 2702bp upstream | BDGP FlyBase |
FBgn0037406 | Osi1 | 9643bp downstream | BDGP FlyBase |
FBgn0037409 | Osi24 | 14198bp upstream | BDGP FlyBase |
FBgn0037405 | CG1077 | 14305bp downstream | BDGP FlyBase |
Sequence
tgagcatggagatggcaaaagcagtcgtacatcctaaatcaggcagtttcttcagatactccacaggcgaaaatattcgctgagtatatttatacaacagggaattggatatgtacgacattttcctgcccaaaatgtcaaagattttccaagaggctgctttcaacgataagctgatggcggaagccatagtcgttggtcgggaacgcaccatcatgatcctcgaggatctggctcctctgcgctacacgaacgcagacagggtgaagcaactggacatggcacataccaagctcgtcctggatatgatggcaaagtttcactctgcagccattatcctgaatcaacgggagccgaaactcttcagtcggaactactcttcgcacttcttctcaaggggcaaaaatgtttgttggttgttaagaccaagccgaatctgaagagtcgct
PCR verification status
Line verified as correct.
No slide loaded.