| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT38145 | chr3R 3745729–3746192 (463 bp) | CG10445, lds |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0037531 | CG10445 | overlapping | BDGP FlyBase |
| FBgn0002542 | lds | 424bp upstream | BDGP FlyBase |
| FBgn0261453 | scaRNA:mgU2-41 | 1945bp upstream | BDGP FlyBase |
| FBgn0014931 | CG2678 | 3458bp downstream | BDGP FlyBase |
| FBgn0000504 | dsx | 4316bp upstream | BDGP FlyBase iFly |
Sequence
ttccattgggtatattggactgcttccatacctggattgggtattatttaagcttgagatcacagataaactgcaacacggcggcaagtccgatctcgaacacggactccgtggaactgaaaacgactctattaggatgaacaacaaagtaaatgctcccggaaaacctacgatctaattccatttgataactaaaagctcaaaaaacgaagcgacaagttaaaagattcattaaatcttttaaaataaacaccgggtaatcgataatcgattttaaaaggtgcattataaccgatcatttcgttgcgaagcgttcacactgtgggcagatggtaccaaaatatgtgcagtaggctcgatttttgatgtttaaactatttggcctgccacacgactcggcgcgatcttctgctttctaaaatatcgatagtttgtggcattgttttgatcaggtggcatctcca
PCR verification status
Line verified as correct.
No slide loaded.