ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT39979 | chr3R 7233635–7234164 (529 bp) | mRpL40, pros |
![]() ![]() ![]() ![]() ![]() ![]() active |
ventral ectoderm anlage, head epidermis dorsal primordium subset, brain anlage subset | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | ventral ectoderm anlage | 4 |
7-8 | procephalic ectoderm anlage | 2 |
9-10 | brain anlage subset | 3 |
9-10 | ventral nerve cord anlage subset | 3 |
11-12 | head epidermis dorsal primordium subset | 4 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0037892 | mRpL40 | 5bp upstream | BDGP FlyBase |
FBgn0004595 | pros | 287bp downstream | BDGP FlyBase iFly |
FBgn0264694 | mgr | 879bp upstream | BDGP FlyBase |
FBgn0011774 | Irbp | 2134bp upstream | BDGP FlyBase |
FBgn0263480 | snoRNA:Irbp-a | 2935bp upstream | BDGP FlyBase |
Sequence
tcgctaggacattgaacagcaacaaaaacagctgttcgtacattacgcaaaggttttttccacatttgtttattaaaaatgtcgctgctgggcgcctttgccaggtaagtgaatgcacctggtccctggtcacacaatcactcactccccacctgccttctgtctcagattgagtctgcagagaagtggcggcgtcgccggtgccgcctttgcacgttgcctccacacgacaccagttctttgtgcggagcccctgaagaaaaagaagaaactggatccgcagattgtcaagcagcgcgaggatcgcaagaagaagaagatcgaaaagcagattcgccggctggagaagaatgcccgtcagctgaagcccgtggatgaactggaggttccactggagctcatcgacgaaaaggagtaggttctcatacgggtttccctcatatgctgagatgtaatgctatcctatcgttcagcaaacggcagcggaagctagctccactgaccatcgaccagttggaggaacgtgctct
PCR verification status
Line verified as correct.
No slide loaded.