| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT39979 | chr3R 7233635–7234164 (529 bp) | mRpL40, pros |
      active |
ventral ectoderm anlage, head epidermis dorsal primordium subset, brain anlage subset | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | ventral ectoderm anlage | 4 |
| 7-8 | procephalic ectoderm anlage | 2 |
| 9-10 | brain anlage subset | 3 |
| 9-10 | ventral nerve cord anlage subset | 3 |
| 11-12 | head epidermis dorsal primordium subset | 4 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0037892 | mRpL40 | 5bp upstream | BDGP FlyBase |
| FBgn0004595 | pros | 287bp downstream | BDGP FlyBase iFly |
| FBgn0264694 | mgr | 879bp upstream | BDGP FlyBase |
| FBgn0011774 | Irbp | 2134bp upstream | BDGP FlyBase |
| FBgn0263480 | snoRNA:Irbp-a | 2935bp upstream | BDGP FlyBase |
UCSC snapshot
Sequence
tcgctaggacattgaacagcaacaaaaacagctgttcgtacattacgcaaaggttttttccacatttgtttattaaaaatgtcgctgctgggcgcctttgccaggtaagtgaatgcacctggtccctggtcacacaatcactcactccccacctgccttctgtctcagattgagtctgcagagaagtggcggcgtcgccggtgccgcctttgcacgttgcctccacacgacaccagttctttgtgcggagcccctgaagaaaaagaagaaactggatccgcagattgtcaagcagcgcgaggatcgcaagaagaagaagatcgaaaagcagattcgccggctggagaagaatgcccgtcagctgaagcccgtggatgaactggaggttccactggagctcatcgacgaaaaggagtaggttctcatacgggtttccctcatatgctgagatgtaatgctatcctatcgttcagcaaacggcagcggaagctagctccactgaccatcgaccagttggaggaacgtgctct
PCR verification status
Line verified as correct.
No slide loaded.