| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT41699 | chr3R 10526286–10526849 (563 bp) | kibra, Meltrin |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0262127 | kibra | overlapping | BDGP FlyBase iFly |
| FBgn0265140 | Meltrin | 3273bp downstream | BDGP FlyBase |
| FBgn0038256 | CG7530 | 24196bp upstream | BDGP FlyBase |
| FBgn0011217 | eff | 31850bp upstream | BDGP FlyBase iFly |
| FBgn0038252 | CG3509 | 35743bp downstream | BDGP FlyBase |
Sequence
ggagctcagcacgttgtaccacttcaatgtggaatcttccgggttgaactcggccatgctgatctgcacggtgccctaaaatattgaaaatatacaatagttagatcccaataataagtaaagttttgggtctaattatgcttacaataatctcctccttttgtccagtcattgtgaccacagtcacctgcaggctcttggtcaacagcttgtccagcgtgatgggcacggcgaatgtatcattaaaaacaggcttctggaaatcgcccaatgccttggtccttatggaggtcagcgaattcggcagcaacgcagcacggagataactaaaatgtgagcaaggatggtataagtacatgctatagattcatttataataattatatacttacacctgtgagttgtccgccgaggcagtccacagggccagaagattgttggcccgctccagggagacgacaagtactccttcctgtttcagatacttcagtccaatctggacttgtgccagctcctttcgaggcagatgggcacgcgacgcctcgaagacgccagaatcgccgg
PCR verification status
Line verified as correct.
No slide loaded.