ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT43253 | chr3R 13508185–13508443 (258 bp) | alt, CG7655 |
active |
brain broad, ubiquitous, ventral nerve cord broad | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | brain broad | 2 |
13-14 | ubiquitous | 2 |
13-14 | ventral nerve cord broad | 2 |
15-16 | brain broad | 2 |
15-16 | ventral nerve cord broad | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0038535 | alt | overlapping | BDGP FlyBase |
FBgn0038536 | CG7655 | 206bp upstream | BDGP FlyBase |
FBgn0051251 | CG31251 | 1277bp upstream | BDGP FlyBase |
FBgn0051360 | CG31360 | 2634bp upstream | BDGP FlyBase |
FBgn0051249 | CG31249 | 3226bp upstream | BDGP FlyBase |
Sequence
tcgttagtgggaaaattgaaacatttgcaaacagagtgaccgtggcgacatactccaaaaatcgcgccagtcacataatagtcctaaatttggacaactagcgatgactcaagccgccggataaatgcgctatgtttttgtagccgagacacgctacgtggggagagcgatgtttttatcgtggacacaaaccaaattgaaattcttcaccgaagattttatcgcgactgtgccatggtcgcactgattagctcaccga
PCR verification status
Line verified as correct.
No slide loaded.