Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT43253 chr3R 13508185–13508443 (258 bp) alt, CG7655 activityactivityactivityactivityactivityactivity
active
brain broad, ubiquitous, ventral nerve cord broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14brain broad2
13-14ubiquitous2
13-14ventral nerve cord broad2
15-16brain broad2
15-16ventral nerve cord broad2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038535altoverlapping BDGP FlyBase
FBgn0038536CG7655206bp upstream BDGP FlyBase
FBgn0051251CG312511277bp upstream BDGP FlyBase
FBgn0051360CG313602634bp upstream BDGP FlyBase
FBgn0051249CG312493226bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tcgttagtgggaaaattgaaacatttgcaaacagagtgaccgtggcgacatactccaaaaatcgcgccagtcacataatagtcctaaatttggacaactagcgatgactcaagccgccggataaatgcgctatgtttttgtagccgagacacgctacgtggggagagcgatgtttttatcgtggacacaaaccaaattgaaattcttcaccgaagattttatcgcgactgtgccatggtcgcactgattagctcaccga

PCR verification status

Line verified as correct.

No slide loaded.