Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT43546 chr3R 14062998–14063620 (622 bp) repo, CG7156 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0011701repooverlapping BDGP FlyBase iFly
FBgn0038588CG71562144bp upstream BDGP FlyBase
FBgn002023814-3-3epsilon5255bp upstream BDGP FlyBase iFly
FBgn0262559Mdh28559bp downstream BDGP FlyBase
FBgn0038586CG716811195bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgccaactcctcctcctccgctggcgtcggcattcagggggcggcgggcacagcggggggcgtggcagctcctgcagccaaaaaggacggaagcagcagcaagaagaagggcgatcccaatggcatcaagaagaagaagacgaggtaagcggtcgaagctgctacgctgtcaattaatttaacgacgggaaatcaatgaaattatgtggcacaagatgatagcacttgctatttatgaccgtgaccacggggcgtatgagtaatttggagtaaggacattgctagcaactcgcacggaaacccgtgcaatctggggggctaattattaaataatgagtaccgatagcagatagatagatccacagaacatggttatctctatagaattttctaatattctaaaatatagtttcagtttagaacttttttgtaatataaatagatactatgggttttttcatttttccctttttttaatccctattatatgaccaactaactgtatgaatcccattcagactttcatctaatcctctatactttccatttttaccttcagaaccacctttactgcctaccagctggaggagttggagcgtgcctttgaacgtgctccgtatccg

PCR verification status

Line verified as correct.

No slide loaded.