| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT43630 | chr3R 14233817–14234488 (671 bp) | CG31122, CG10864 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0051122 | CG31122 | overlapping | BDGP FlyBase |
| FBgn0038621 | CG10864 | 1985bp upstream | BDGP FlyBase |
| FBgn0038619 | CG7685 | 2094bp downstream | BDGP FlyBase |
| FBgn0264816 | koko | 3370bp downstream | BDGP FlyBase |
| FBgn0038617 | CG12333 | 5380bp downstream | BDGP FlyBase |
Sequence
ggtgatcggcgcattcagcctacgtagcatctccgtaaacaacttctcctcctttctaatccagggtcggcgatcatcctgcacctggtagggcgtcaggtggacatggatgttcatgcctgcttaaagactcccactcgttagttgactcaacttggcatttactctctctccacttacccatccgcgttagtgtttccagcaagctacgggacgtgatccaagtgttcttttggcccccatggccgccatccagccagtacatgtctgaaatccgggagagaaggcggcacatgctgctgtcgtcgggcgtgagcgtcttaagatagtggaactcgtagatgaactataaacaaaaaagaaagtgcagataagtatggtcagttgggtatgggccacaatcctcagataccgattcagcgtttagatttatactctacacgctccatcgacacttctgcataggattgaagctggcgtattggcgagtggatcaactaggtaacgaaccaaacgcgactcacttgattgagcacgacgcagcccttgctaaagccaatcagcaccagcttggatttgtccagattgaggttctcccgccaccacagcggattgctatcgctgcttgccgttgatgtggaggtgcccgttgccgaggctgttgttgcagag
PCR verification status
Line verified as correct.
No slide loaded.