| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT44028 | chr3R 14987445–14988020 (575 bp) | CG42358, CG42359 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0259704 | CG42358 | overlapping | BDGP FlyBase |
| FBgn0259705 | CG42359 | overlapping | BDGP FlyBase |
| FBgn0002962 | nos | 1522bp downstream | BDGP FlyBase iFly |
| FBgn0038683 | CG11779 | 1846bp downstream | BDGP FlyBase |
| FBgn0010768 | sqz | 2498bp upstream | BDGP FlyBase iFly |
Sequence
gctgttgtttcctgttcttcttgcccatctcagccggctaatactggtaatcggtgtgataacctgccttttcgctggacaccgaaatctctgatggaatttagcagtcgatccttgtaacttcgcaccgtttgcacgggtttgctttcgccgttcagctccttcctgccaaacagcagttcggtgactagaatcttggccaaactgggatcaaaactgggattgtccctgagcagtcctgtctcttcgatggccttttccagtgccacacgattttcgctaaattttttcagaaccgtatgcaaagagcgtgtacgctacaagtgaagtgcgagagggaaaagttatacgcatattggtttgatctgcggacgagaggtccaatccacttacggcatgcttctctgcaaatattagggtcttgatgcacttctgctgctccagtgccgccttcaaaatcttggcagtcgccctgtattgggtgggaacttttatggaatgcggttttttactcattgtcgtcacgtgcacgtgtatgtgttgtttgcgctagaataggtgcaaccccaatcacga
PCR verification status
Line verified as correct.
No slide loaded.