ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT44028 | chr3R 14987445–14988020 (575 bp) | CG42358, CG42359 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0259704 | CG42358 | overlapping | BDGP FlyBase |
FBgn0259705 | CG42359 | overlapping | BDGP FlyBase |
FBgn0002962 | nos | 1522bp downstream | BDGP FlyBase iFly |
FBgn0038683 | CG11779 | 1846bp downstream | BDGP FlyBase |
FBgn0010768 | sqz | 2498bp upstream | BDGP FlyBase iFly |
Sequence
gctgttgtttcctgttcttcttgcccatctcagccggctaatactggtaatcggtgtgataacctgccttttcgctggacaccgaaatctctgatggaatttagcagtcgatccttgtaacttcgcaccgtttgcacgggtttgctttcgccgttcagctccttcctgccaaacagcagttcggtgactagaatcttggccaaactgggatcaaaactgggattgtccctgagcagtcctgtctcttcgatggccttttccagtgccacacgattttcgctaaattttttcagaaccgtatgcaaagagcgtgtacgctacaagtgaagtgcgagagggaaaagttatacgcatattggtttgatctgcggacgagaggtccaatccacttacggcatgcttctctgcaaatattagggtcttgatgcacttctgctgctccagtgccgccttcaaaatcttggcagtcgccctgtattgggtgggaacttttatggaatgcggttttttactcattgtcgtcacgtgcacgtgtatgtgttgtttgcgctagaataggtgcaaccccaatcacga
PCR verification status
Line verified as correct.
No slide loaded.