ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT44063 | chr3R 15058378–15059007 (629 bp) | unc79, CG3773 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0038693 | unc79 | overlapping | BDGP FlyBase |
FBgn0038692 | CG3773 | 1825bp downstream | BDGP FlyBase |
FBgn0038691 | CG5250 | 3381bp downstream | BDGP FlyBase |
FBgn0038690 | CG11703 | 4477bp downstream | BDGP FlyBase |
FBgn0262468 | vib | 6006bp downstream | BDGP FlyBase |
Sequence
ctttggcaatgctgcggaaatggtgatgacggattttcacttaaaagagagaatattattaaataacttccttcatattagatcattgcttacttttcatttgagtttggaacacctgcaagaagattccgttgggtgctaactggtgaagcacgcatcggaagaactgacaggccaccgcctgggcactgctggccaaaggtggaccattctcgccttgccaggcatgggtgctacttaagcagatcctaaaatggaggcgaatgtaatctgagacttatgcatttactagtgattccactaaccgtgaagtcatggtgagaatctcgggcaggaatggtgctgccatggcaggttctcgatgaataaaggttcctaggattactatgaagatgccgatctcctcatccgtgtactcctcaatgtgggcaccgcagtcggagcagcgttccacgatggtgtaatctccaacacgacgagagctctgcgggattaaatatttataattaaataccccactgagtagttaaattaaaatgactcaccccacgtggagcatgaggggttgagtggattccatgcccattggaggcctctgcaccgatctcatcgtcatcatcgggttctgga
PCR verification status
Line verified as correct.
No slide loaded.