ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT4415 | chr2L 8780805–8781292 (487 bp) | CG9468, CG42710 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0032069 | CG9468 | overlapping | BDGP FlyBase |
FBgn0261627 | CG42710 | 994bp upstream | BDGP FlyBase |
FBgn0032068 | CG9466 | 4543bp downstream | BDGP FlyBase |
FBgn0032067 | CG9465 | 8462bp downstream | BDGP FlyBase |
FBgn0032066 | CG9463 | 12096bp downstream | BDGP FlyBase |
Sequence
aatggggcaccatgtgaatgttgatcatgttcgtcttggttttggggcatgcctgaaaagcattataaacgttgaatggtttagttgtttgttagtccatagtatttaatggttgaaaacaaaatcggtttgatgattagcaacctgaacattaaatgtcatgttcattaagcatttttgttgccgttttttgagcataaaggaatgtaaatttatttaatcactttcacggtatttacatccttttcaaatttcacatatattctattcctgtcgcattctggcattcacttctcacctcgtatccacaagcctcctcagatggcctcacactgatggccaaaagggccacaaaaagcacaatgccgcacaaatacttcatggcgacgactttacaatttgttttcgaactgaccgcgaatacagtttcgattcgagaacagaactgactttctttagaaattggaactgcttttataggagggccc
PCR verification status
Line verified as correct.
No slide loaded.