| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT44762 | chr3R 16377985–16378245 (260 bp) | Stat92E, att-ORFA |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0016917 | Stat92E | overlapping | BDGP FlyBase iFly |
| FBgn0067783 | att-ORFA | 122bp upstream | BDGP FlyBase |
| FBgn0067782 | att-ORFB | 372bp upstream | BDGP FlyBase |
| FBgn0043457 | CG5180 | 5667bp upstream | BDGP FlyBase |
| FBgn0040575 | CG15922 | 7445bp upstream | BDGP FlyBase |
Sequence
gcgaacgcgactaccagcatatttcgatatacagcacccccgcaaaagatgttatcgcgtaatcgccggaggtgccacctgtcacaaccgatggcgcgcgttttaaaaacgattgagataatcgatcagttaaacaattttgtaaattttaataataaaaacacactaacatacaagaattacatagtatatgctggtgtgaacaccctcaaattcatgactattttaacagtcgcagcgccttgacattgagttggcaat
PCR verification status
Line verified as correct.
No slide loaded.