| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT45901 | chr3R 18550289–18550784 (495 bp) | Irp-1A, CG4813 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0024958 | Irp-1A | overlapping | BDGP FlyBase |
| FBgn0039013 | CG4813 | 317bp upstream | BDGP FlyBase |
| FBgn0266409 | CG45049 | 2400bp upstream | BDGP FlyBase |
| FBgn0051151 | wge | 3418bp downstream | BDGP FlyBase |
| FBgn0039015 | Takl2 | 7789bp upstream | BDGP FlyBase |
Sequence
atgagcgcgtgaggaaccgctaccaggcaaaacttgctcatcactaacgcaaacattatattatcgataactgaacatgaaaacaaaccggtacacagtaaaaaatatttatttattacttaaaatgaaacatttgtaaattatagtggaataatttatcatttttgtgattcgaaaataatattggatataatattggattgattgcttttttattttagttcaaaataaggtatttaaaataacttgtttgcatgtctttaaacgcttttcccttcctacatgctaatttcgttaaataaacttaaatattaattatgttttctgcggtttattgcaatagttacatggtaggcttattgtaatgtcacgtagtataattggtatttgtaatctatataaataatatgtataggggattatcatctaaagctgcgtcgggatgcaaagcctgttttatggcgcaagcaatttggcagcggggataacaagtctg
PCR verification status
Line verified as correct.
No slide loaded.