ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT48907 | chr3R 24346130–24346485 (355 bp) | CG31051, Ppn |
active |
brain broad, ventral nerve cord broad | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | brain broad | 2 |
13-14 | ventral nerve cord broad | 2 |
15-16 | brain broad | 2 |
15-16 | ventral nerve cord broad | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0051051 | CG31051 | overlapping | BDGP FlyBase |
FBgn0003137 | Ppn | 257bp upstream | BDGP FlyBase |
FBgn0013813 | Dhc98D | 1011bp downstream | BDGP FlyBase |
FBgn0039588 | CG12413 | 21866bp upstream | BDGP FlyBase |
FBgn0039585 | CG1894 | 34347bp downstream | BDGP FlyBase |
Sequence
tcgatgccgctatcctccatagttttaaaattaaactttacaatgtttaaagaagcgagttaaacgcgatgacaacacaaacaaattttattgtcttcctctgcacgactccagaactccaatcaaccccagagtttagggcgcaggctccacgaacagctgctgctgggaaaactttggaaaatcaataaccccttgccacgaaagcgttgccagatggggtggcattttcaaattgtgggccatcccctgagtttaatcttttatacatatgcactctttattatgtagttttaatttatttacaattattggtttttaggcttaaatgctttactcgttgcacagaaatgtcg
PCR verification status
Line verified as correct.
No slide loaded.