ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT48918 | chr3R 24369844–24370541 (697 bp) | CG12413, Ppn |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0039588 | CG12413 | overlapping | BDGP FlyBase |
FBgn0003137 | Ppn | 3799bp downstream | BDGP FlyBase |
FBgn0051051 | CG31051 | 23608bp downstream | BDGP FlyBase |
FBgn0013813 | Dhc98D | 24725bp downstream | BDGP FlyBase |
FBgn0000659 | fkh | 36961bp upstream | BDGP FlyBase iFly |
Sequence
cgttccttctgctcatctgcgtttgtttcttcaggtgtggccaccacccgtgttttggcacccagtttcttggcaatctcctggatgattttgaggtctgcaagcttaaaagccggttcaatattgtcagcgcccttgacatatagcatcgcctcttgaacatcatctggaagataaatgatgatcacaattactttaatatattaagatataaccagtgaatagaatgtttacccagtgacctttccagttccttggccagttgggccacggtcatgtgcctccagatgtcagaggcgcctccgcccgccgtttgaaacttcttgggggagtactctataattcttggggatttctaaatcaattagtgagtgtgccctctgggatcaaggggattattaagagattcaagttttccggctttgagattcactggcatagtggctctaaaacctaccttctcttctgctgttttccggcgtttcaacctggcggcgctcacatggaattctctttgaaacgccagtggcagttgccactgtgtgactgctctgctgaagtggagagtattaccaagtcgacttatattaatgatccgcaacattttttatagatgaaattatattcttatagtttatgttttagatgtcgcgtaacgcagcagctgactgataccagggacggaaatcaaatcagct
PCR verification status
Line verified as correct.
No slide loaded.