| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT48918 | chr3R 24369844–24370541 (697 bp) | CG12413, Ppn |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0039588 | CG12413 | overlapping | BDGP FlyBase |
| FBgn0003137 | Ppn | 3799bp downstream | BDGP FlyBase |
| FBgn0051051 | CG31051 | 23608bp downstream | BDGP FlyBase |
| FBgn0013813 | Dhc98D | 24725bp downstream | BDGP FlyBase |
| FBgn0000659 | fkh | 36961bp upstream | BDGP FlyBase iFly |
Sequence
cgttccttctgctcatctgcgtttgtttcttcaggtgtggccaccacccgtgttttggcacccagtttcttggcaatctcctggatgattttgaggtctgcaagcttaaaagccggttcaatattgtcagcgcccttgacatatagcatcgcctcttgaacatcatctggaagataaatgatgatcacaattactttaatatattaagatataaccagtgaatagaatgtttacccagtgacctttccagttccttggccagttgggccacggtcatgtgcctccagatgtcagaggcgcctccgcccgccgtttgaaacttcttgggggagtactctataattcttggggatttctaaatcaattagtgagtgtgccctctgggatcaaggggattattaagagattcaagttttccggctttgagattcactggcatagtggctctaaaacctaccttctcttctgctgttttccggcgtttcaacctggcggcgctcacatggaattctctttgaaacgccagtggcagttgccactgtgtgactgctctgctgaagtggagagtattaccaagtcgacttatattaatgatccgcaacattttttatagatgaaattatattcttatagtttatgttttagatgtcgcgtaacgcagcagctgactgataccagggacggaaatcaaatcagct
PCR verification status
Line verified as correct.
No slide loaded.