| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT49508 | chr3R 25500687–25501146 (459 bp) | Bub3, Cap-D2 |
active |
ventral nerve cord anlage subset | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | ventral nerve cord anlage subset | 2 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0025457 | Bub3 | overlapping | BDGP FlyBase iFly |
| FBgn0039680 | Cap-D2 | 686bp upstream | BDGP FlyBase |
| FBgn0039679 | ppk19 | 743bp downstream | BDGP FlyBase |
| FBgn0039678 | Obp99a | 2632bp downstream | BDGP FlyBase |
| FBgn0039677 | ppk30 | 3488bp downstream | BDGP FlyBase |
Sequence
gggctcctcgtgggcaccaattatgctttccgcctgggtgttgacatcaaagagacgcagctggttgtccagggagccactgaccacgtgcactatgtcctgcggatcgttggttgaataggggattgttaatgtgtacgaaggagtctcaccatgaaggcacagtcgagaagaggggcatcctgcacgaatttctgacgcagctggtttgccggcacatcatagaatctaagtgttccgtcccaagaagacgccgccatgtattgattcgatttggggccgaatttcacagcggagatcaggtcctccggcggattgttaagcttgaactctgggggacgcattttgtcaagttttctgctagcaacttgtggataataaaacaataaattcaaacagaaactgcttaaaacaaatcaaactccgaatttgcacggcgtctggagaagagatgcgagta
PCR verification status
Line verified as correct.
No slide loaded.