| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT50647 | chr3R 27619610–27619830 (220 bp) | CG2118, Acf1 |
weak |
ubiquitous | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | ubiquitous | 1 |
| 7-8 | ubiquitous | 1 |
| 9-10 | ubiquitous | 1 |
| 11-12 | ubiquitous | 1 |
| 13-14 | ubiquitous | 1 |
| 15-16 | ubiquitous | 1 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0039877 | CG2118 | overlapping | BDGP FlyBase |
| FBgn0027620 | Acf1 | 93bp upstream | BDGP FlyBase iFly |
| FBgn0005632 | faf | 3208bp downstream | BDGP FlyBase iFly |
| FBgn0250755 | CG42233 | 5746bp upstream | BDGP FlyBase |
| FBgn0039879 | Ir100a | 7075bp upstream | BDGP FlyBase |
Sequence
tctggactatttatcgaactgttgacatccatccgaccgcgtccttacggttttctgcgctcgtgaagttcggtaacattgttcgcagaaactcgataaccgatagtttaacgtcgaagagcgataggccccaaaatatgcgcgtgaaaatagattgtgcgctataaaataaacggatttaggtagttggtgttgaggaagccagccacaaacatagtaga
PCR verification status
Line verified as correct.
No slide loaded.