ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT50648 | chr3R 27624326–27624704 (378 bp) | Acf1, CG42233 |
![]() ![]() ![]() ![]() ![]() ![]() active |
dorsal epidermis subset, posterior spiracle, head subset | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | dorsal epidermis subset | 3 |
13-14 | posterior spiracle | 3 |
15-16 | head subset | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0027620 | Acf1 | overlapping | BDGP FlyBase iFly |
FBgn0250755 | CG42233 | 1030bp upstream | BDGP FlyBase |
FBgn0039879 | Ir100a | 2359bp upstream | BDGP FlyBase |
FBgn0039877 | CG2118 | 4698bp downstream | BDGP FlyBase |
FBgn0039881 | CG1971 | 6864bp upstream | BDGP FlyBase |
Sequence
cgccggtgaagatacgatcgaagacgagtcgtaagttaaaaactggattgaaaattaaatttagataatgaacccattgcaatccacagagatgaggaaaaggtgtgtcagaagtgtttctacgatggcggtgaaatcaaatgtgtgcaatgcaggctattctttcacctggaatgtgttcacctcaagcgaccgcctcgcacagatttcgtttgtaaaacctgcaagccgatgccacaacgacctaggcgccggcacagtaacagtaagtccacaaatttctccttaatgaatagctcactaatagcccgtgtgatttctgtccaacaagtgaatggtgatcatgaccgcgatgaggaggagccaaaagcaaagcgac
PCR verification status
Line verified as correct.
No slide loaded.