| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT50648 | chr3R 27624326–27624704 (378 bp) | Acf1, CG42233 |
active |
dorsal epidermis subset, posterior spiracle, head subset | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | dorsal epidermis subset | 3 |
| 13-14 | posterior spiracle | 3 |
| 15-16 | head subset | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0027620 | Acf1 | overlapping | BDGP FlyBase iFly |
| FBgn0250755 | CG42233 | 1030bp upstream | BDGP FlyBase |
| FBgn0039879 | Ir100a | 2359bp upstream | BDGP FlyBase |
| FBgn0039877 | CG2118 | 4698bp downstream | BDGP FlyBase |
| FBgn0039881 | CG1971 | 6864bp upstream | BDGP FlyBase |
Sequence
cgccggtgaagatacgatcgaagacgagtcgtaagttaaaaactggattgaaaattaaatttagataatgaacccattgcaatccacagagatgaggaaaaggtgtgtcagaagtgtttctacgatggcggtgaaatcaaatgtgtgcaatgcaggctattctttcacctggaatgtgttcacctcaagcgaccgcctcgcacagatttcgtttgtaaaacctgcaagccgatgccacaacgacctaggcgccggcacagtaacagtaagtccacaaatttctccttaatgaatagctcactaatagcccgtgtgatttctgtccaacaagtgaatggtgatcatgaccgcgatgaggaggagccaaaagcaaagcgac
PCR verification status
Line verified as correct.
No slide loaded.