ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT55432 | chrX 1562707–1563338 (631 bp) | Mur2B, CG3740 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0025390 | Mur2B | overlapping | BDGP FlyBase |
FBgn0023530 | CG3740 | overlapping | BDGP FlyBase |
FBgn0000482 | dor | 224bp downstream | BDGP FlyBase |
FBgn0001189 | hfw | 896bp upstream | BDGP FlyBase |
FBgn0000210 | br | 3806bp downstream | BDGP FlyBase iFly |
Sequence
ctgcaccagctgctctcgctgtgcgtccgtcaggtcgtttaggatgacttcgcccagcggacggaatgtgcctgttcgggaggagggaagtggaaatgtagtgagactgagtacgggagttctcctccgcttaccgcttgtcatcttgtaggcggcgattccgccggcggccccgccaaccgccagcccaacggggcccaggagcatgccacccgcaaaggagcaggcggcgcagattgccgctcccttgccggactgcttgacggcgacgcggacgttgcgctcgtccgctacgatggctatcgcctccatcaactcgcgcgtatctatgggcatatttaggctacgtggagttggcccgaatttcgcaacgctatgctagtatttcctgtttagactttgttccgtgcggcagtatgacgtttccgattacgccacccgttccgtttgtatcctgccttttagtgttggtcttgaattctccaacttgctactcgacaacataaacaatttcacggaatccgcttgaagggaactattaaaaagcttatatttgacttaaaaaacagcaacttgattaaacttgtgagcgccagattcagagatgcgcaaacggcggtcacaatcgacgt
PCR verification status
Line verified as correct.
No slide loaded.