Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT55432 chrX 1562707–1563338 (631 bp) Mur2B, CG3740 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0025390Mur2Boverlapping BDGP FlyBase
FBgn0023530CG3740overlapping BDGP FlyBase
FBgn0000482dor224bp downstream BDGP FlyBase
FBgn0001189hfw896bp upstream BDGP FlyBase
FBgn0000210br3806bp downstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

ctgcaccagctgctctcgctgtgcgtccgtcaggtcgtttaggatgacttcgcccagcggacggaatgtgcctgttcgggaggagggaagtggaaatgtagtgagactgagtacgggagttctcctccgcttaccgcttgtcatcttgtaggcggcgattccgccggcggccccgccaaccgccagcccaacggggcccaggagcatgccacccgcaaaggagcaggcggcgcagattgccgctcccttgccggactgcttgacggcgacgcggacgttgcgctcgtccgctacgatggctatcgcctccatcaactcgcgcgtatctatgggcatatttaggctacgtggagttggcccgaatttcgcaacgctatgctagtatttcctgtttagactttgttccgtgcggcagtatgacgtttccgattacgccacccgttccgtttgtatcctgccttttagtgttggtcttgaattctccaacttgctactcgacaacataaacaatttcacggaatccgcttgaagggaactattaaaaagcttatatttgacttaaaaaacagcaacttgattaaacttgtgagcgccagattcagagatgcgcaaacggcggtcacaatcgacgt

PCR verification status

Line verified as correct.

No slide loaded.