| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT55714 | chrX 2151498–2151995 (497 bp) | CG3078, l(1)G0144 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0023524 | CG3078 | overlapping | BDGP FlyBase |
| FBgn0027296 | l(1)G0144 | 2742bp upstream | BDGP FlyBase |
| FBgn0029608 | CG3091 | 3269bp downstream | BDGP FlyBase |
| FBgn0023527 | CG3071 | 5372bp upstream | BDGP FlyBase |
| FBgn0023525 | CG3191 | 5473bp downstream | BDGP FlyBase |
Sequence
aaatgggtgacggcgagtatgtggtgaagtgctgctggaaaagatgcaagaaaagggtattaggatatagcaagaatccaatcatctggcaggctaatggtattacagccagctacctttcactttaacaatagcaaagggggagtagtcggagtagggaagtagttgtagttcaacttggaaagagagtccgtgtccgaacactcacctttcacgacacaccaatgaccacagggcaccccttttgtgcacacatcgccacatgatagttgagtgtccaggaaaaaagggagataagctcccagattctatttatatgcgacaggtgtcaccatgccggaaagcaagtgacatgaattatataaaggcttttcacacagaggcggactttttatgtgttcacctgagaactcacctccatcatctgctcttcccagacgttctgggctcctcctgaactgcgggttcgaagcactctgtgcctggtggtcagcgaat
PCR verification status
Line verified as correct.
No slide loaded.