ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT55714 | chrX 2151498–2151995 (497 bp) | CG3078, l(1)G0144 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0023524 | CG3078 | overlapping | BDGP FlyBase |
FBgn0027296 | l(1)G0144 | 2742bp upstream | BDGP FlyBase |
FBgn0029608 | CG3091 | 3269bp downstream | BDGP FlyBase |
FBgn0023527 | CG3071 | 5372bp upstream | BDGP FlyBase |
FBgn0023525 | CG3191 | 5473bp downstream | BDGP FlyBase |
Sequence
aaatgggtgacggcgagtatgtggtgaagtgctgctggaaaagatgcaagaaaagggtattaggatatagcaagaatccaatcatctggcaggctaatggtattacagccagctacctttcactttaacaatagcaaagggggagtagtcggagtagggaagtagttgtagttcaacttggaaagagagtccgtgtccgaacactcacctttcacgacacaccaatgaccacagggcaccccttttgtgcacacatcgccacatgatagttgagtgtccaggaaaaaagggagataagctcccagattctatttatatgcgacaggtgtcaccatgccggaaagcaagtgacatgaattatataaaggcttttcacacagaggcggactttttatgtgttcacctgagaactcacctccatcatctgctcttcccagacgttctgggctcctcctgaactgcgggttcgaagcactctgtgcctggtggtcagcgaat
PCR verification status
Line verified as correct.
No slide loaded.