| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT57089 | chrX 4961770–4962316 (546 bp) | ovo, CG32767 |
      active |
hemocyte, macrophage | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | hemocyte | 2 |
| 13-14 | macrophage | 2 |
| 15-16 | hemocyte | 3 |
| 15-16 | macrophage | 3 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0003028 | ovo | overlapping | BDGP FlyBase iFly |
| FBgn0052767 | CG32767 | 3290bp upstream | BDGP FlyBase |
| FBgn0266096 | CR44833 | 3870bp downstream | BDGP FlyBase |
| FBgn0266098 | rg | 18022bp upstream | BDGP FlyBase |
| FBgn0029745 | Rpn13R | 64161bp upstream | BDGP FlyBase |
UCSC snapshot
Sequence
cccaccgtttccgttttgaatgagagcaaagtcttgcagcggcgcgtaagtgcggaagatgagtcggaaactggacagctgtgggcctccaagagattagctatcatttgcgtttcaatggactgcggttatcgatggcgcttaccacgaaacattaggttccagtccattgaaaagttttagtgttaatttactggattaaagaagcttggagcttggagcttggagtttaccgacgattctttctaggaactaacccgcttatgtgtcttctatctatagttgtctgtagtttgtgcttgtctgtgattgtcttagatttgttaactccttcaatatgtttaacccattgtgtgtaatcataattaatgaacgttcgttctatgcatttttcaacagttgggcttgccgccggatctgcagcttgagtttgtgaacggcggccatggcattaagaacccgctggccgtggagaatgcccacggtggccatcaccgaattcgcaacatcgattgcattgatgatctcagcaagcatggccaccact
PCR verification status
Line verified as correct.
No slide loaded.