ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT57089 | chrX 4961770–4962316 (546 bp) | ovo, CG32767 |
![]() ![]() ![]() ![]() ![]() ![]() active |
hemocyte, macrophage | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | hemocyte | 2 |
13-14 | macrophage | 2 |
15-16 | hemocyte | 3 |
15-16 | macrophage | 3 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0003028 | ovo | overlapping | BDGP FlyBase iFly |
FBgn0052767 | CG32767 | 3290bp upstream | BDGP FlyBase |
FBgn0266096 | CR44833 | 3870bp downstream | BDGP FlyBase |
FBgn0266098 | rg | 18022bp upstream | BDGP FlyBase |
FBgn0029745 | Rpn13R | 64161bp upstream | BDGP FlyBase |
Sequence
cccaccgtttccgttttgaatgagagcaaagtcttgcagcggcgcgtaagtgcggaagatgagtcggaaactggacagctgtgggcctccaagagattagctatcatttgcgtttcaatggactgcggttatcgatggcgcttaccacgaaacattaggttccagtccattgaaaagttttagtgttaatttactggattaaagaagcttggagcttggagcttggagtttaccgacgattctttctaggaactaacccgcttatgtgtcttctatctatagttgtctgtagtttgtgcttgtctgtgattgtcttagatttgttaactccttcaatatgtttaacccattgtgtgtaatcataattaatgaacgttcgttctatgcatttttcaacagttgggcttgccgccggatctgcagcttgagtttgtgaacggcggccatggcattaagaacccgctggccgtggagaatgcccacggtggccatcaccgaattcgcaacatcgattgcattgatgatctcagcaagcatggccaccact
PCR verification status
Line verified as correct.
No slide loaded.