| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT58994 | chrX 8767923–8768574 (651 bp) | Moe, CG12075 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0011661 | Moe | overlapping | BDGP FlyBase iFly |
| FBgn0030065 | CG12075 | 1117bp downstream | BDGP FlyBase |
| FBgn0030066 | CG1885 | 24664bp upstream | BDGP FlyBase |
| FBgn0030067 | Rbm13 | 27801bp upstream | BDGP FlyBase |
| FBgn0011586 | e(r) | 30254bp upstream | BDGP FlyBase |
Sequence
tctcaccgctccctctctctttcccgcgcactatcgatctctgatctttgatagcttttacatgttctcaaactgatcgacgcgacgctttgtgttgcccttacgaatctcgcggagcgtcttgtacttgtcacgtccctggcgaacgttctcgcgatgaatcttatcgtttgccgtctctttcgtctcgtcgcgagactgcgccaaatcttgtttcagagcctagatatagatatatatatatatcaaattgatattgttagttgagtggagcataagggactcgatttcgaacccaccttgagctgatcgtgcaagcgttcgttgcgctcggccagcgtgcgtctgtcctcgatggggtccttgatatgctcgtcggtgtccaggtcgcgcgacacatcgccaccggcatcgccgttcgtcagctcctcctcgttctcgttctcatcctcggccacgtggtgatgctgcggcgttgtcgacgcggccagcagagcggcagcggcttcagcctacaaaaacgacaatgttcagtataaagttgaacacaaaatggtatcaagactatattcattggttttttcgatgccaacaaatagtgaaaaaagtgtaccgcaatgacctgcttgcgtcgggcgtcttccacttcgtc
PCR verification status
Line verified as correct.
No slide loaded.