| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT59191 | chrX 9136612–9137297 (685 bp) | mxc, Larp7 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0260789 | mxc | overlapping | BDGP FlyBase |
| FBgn0260771 | Larp7 | 1238bp upstream | BDGP FlyBase |
| FBgn0000077 | amx | 3336bp upstream | BDGP FlyBase |
| FBgn0010269 | Dsor1 | 4763bp upstream | BDGP FlyBase |
| FBgn0052704 | Ir8a | 5995bp downstream | BDGP FlyBase iFly |
Sequence
tgctaaacgaaggcgaagaaatgctgttcacgggagaatgggtgcgcctggggaaaaggggtaagagagcaatgagaattccgatgtgcttgtgtcaaggaaaaatctataattacaagcgccttctcttgcgatgcgactgtgatatggtgggctcgcctggggtgctgctttcattggtacagctactcctctcgccggcggctatcagttcgctgacccgttcggacagcttcatctgctgcagctgcatacgcatatccagcggcagcttctgcacggcaccggccactgaaaagagagattttcggtcagccgcaaaaaaaaagaaacgcaaggagcgtgctaatttacccaagcttgtgatcttgacatgctcgcagattatctcctccagacccccgtgaaggaagttgtgcgtctgcaggccctgtttaagggccaggaactcgtggcgcaggtgaggcgatgtgcgacacagagtgtgtgcggccctttttagattctggttgactaggtagcctacaaaatggaagagcataaatattgcgagctagaaaagcgtccagggaaaacctacccaggaccaagcgagccacgtccgaatgcaggacaatcgactccatggctggactttccgactcagctaagcgtcaccatccactcgcttttcgccttgcctttct
PCR verification status
Line verified as correct.
No slide loaded.