ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT61233 | chrX 13262168–13262583 (415 bp) | Syt12, dmrt11E |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0261085 | Syt12 | overlapping | BDGP FlyBase |
FBgn0030477 | dmrt11E | 56bp upstream | BDGP FlyBase |
FBgn0030478 | CG1640 | 2471bp upstream | BDGP FlyBase |
FBgn0030479 | Rbp1-like | 12031bp upstream | BDGP FlyBase |
FBgn0030480 | Tim9a | 17075bp upstream | BDGP FlyBase |
Sequence
cgtaaaccgaaattgactcaaataaacgaataaagatattaaacgaagacaggccagaaatcaatatgcactttgacgaaacacggagtccaaacaaagatgtacggattggaaaggtatagtgaaacatgcctataaagaaccatagaagattcacagatacttttaccttcttaaattctttaagatgccccaagtaattgattaagcaagtgatccataacctatatatatatgctatatatgtatatattactaatctttgaaatcgctttcaatgagttcctcctgtagtcgaatgtatcttttgcatgctgatgcgagacatctgtgcggccattggatcttctatatttagagccagcgattagcagccaatggcaggcaaggaaccgatcccgagtccgatcccttgc
PCR verification status
Line verified as correct.
No slide loaded.