ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT62501 | chrX 15812411–15812962 (551 bp) | CG8909, CG8916 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0030706 | CG8909 | overlapping | BDGP FlyBase |
FBgn0030707 | CG8916 | 3577bp upstream | BDGP FlyBase |
FBgn0010240 | Lcch3 | 6727bp upstream | BDGP FlyBase |
FBgn0266351 | CR45000 | 8409bp upstream | BDGP FlyBase |
FBgn0010315 | CycD | 8703bp downstream | BDGP FlyBase iFly |
Sequence
ctcgatggaagctgtcgcaagaggatcgtcgaggataacttgggtgacccacgatcgcttattgtgcatccaaagaaagcgtaagattacctcaattattcagtttatatttgtatactactcatcatcaccattgtagctacctgttctggtcggattggagctcgccggcgaaaatcgaacgtagctacttggatggctcaaatcgcacggtgatcataacatctggaatcggctttccaacgggccttaccatagatttcacgttagttgcgctaggcggtacttaaatttggaatactatacaatattcatattattactttacagcaatcgccgcttgctgtgggccgacgccctggaggacaatatcggtcaagttgatttcaatggtaaacgtcgtcagaccattgttccttatgcaccgcatccttttggtctgactttggtaagactgactgcatgttttaccatgcaaaattcactaataagcctcatcattcatttagtttgaaaatagtatattctggacggactggtacaacaagtcgg
PCR verification status
Line verified as correct.
No slide loaded.