| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT8359 | chr2L 16352569–16352972 (403 bp) | chif, CG42231 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0000307 | chif | overlapping | BDGP FlyBase iFly |
| FBgn0087041 | CG42231 | overlapping | BDGP FlyBase |
| FBgn0028506 | CG4455 | 365bp upstream | BDGP FlyBase |
| FBgn0025678 | CaBP1 | 2375bp upstream | BDGP FlyBase |
| FBgn0265578 | CG44405 | 10246bp downstream | BDGP FlyBase |
Sequence
gtacacggacagggcagcgcacacacgctcggcaaccaaattttcgtcgtgttatcgataactatgttggctggcgatggtcgatggttgctaagcggcgtgactgagtcgcggtcacatatcgttttaagggaaaaagtcacggattagcagttttaaaaaaggtctagtttaatattgattcgtttttcgtgacgagagacattaattattcattgaatttatttatttcatttaaaaatatacactaacgtacttacaattttgttaacatgaatctatgatatataccataaatttaaaatttgtaattgcgatttgaaacatcgacagcgatggctatcttcatgtatcgataggcaacgacagtccgtccctaccagcaacgcgaaaggtttttgtct
PCR verification status
Line verified as correct.
No slide loaded.