ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT8359 | chr2L 16352569–16352972 (403 bp) | chif, CG42231 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0000307 | chif | overlapping | BDGP FlyBase iFly |
FBgn0087041 | CG42231 | overlapping | BDGP FlyBase |
FBgn0028506 | CG4455 | 365bp upstream | BDGP FlyBase |
FBgn0025678 | CaBP1 | 2375bp upstream | BDGP FlyBase |
FBgn0265578 | CG44405 | 10246bp downstream | BDGP FlyBase |
Sequence
gtacacggacagggcagcgcacacacgctcggcaaccaaattttcgtcgtgttatcgataactatgttggctggcgatggtcgatggttgctaagcggcgtgactgagtcgcggtcacatatcgttttaagggaaaaagtcacggattagcagttttaaaaaaggtctagtttaatattgattcgtttttcgtgacgagagacattaattattcattgaatttatttatttcatttaaaaatatacactaacgtacttacaattttgttaacatgaatctatgatatataccataaatttaaaatttgtaattgcgatttgaaacatcgacagcgatggctatcttcatgtatcgataggcaacgacagtccgtccctaccagcaacgcgaaaggtttttgtct
PCR verification status
Line verified as correct.
No slide loaded.