Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT8359 chr2L 16352569–16352972 (403 bp) chif, CG42231 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000307chifoverlapping BDGP FlyBase iFly
FBgn0087041CG42231overlapping BDGP FlyBase
FBgn0028506CG4455365bp upstream BDGP FlyBase
FBgn0025678CaBP12375bp upstream BDGP FlyBase
FBgn0265578CG4440510246bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gtacacggacagggcagcgcacacacgctcggcaaccaaattttcgtcgtgttatcgataactatgttggctggcgatggtcgatggttgctaagcggcgtgactgagtcgcggtcacatatcgttttaagggaaaaagtcacggattagcagttttaaaaaaggtctagtttaatattgattcgtttttcgtgacgagagacattaattattcattgaatttatttatttcatttaaaaatatacactaacgtacttacaattttgttaacatgaatctatgatatataccataaatttaaaatttgtaattgcgatttgaaacatcgacagcgatggctatcttcatgtatcgataggcaacgacagtccgtccctaccagcaacgcgaaaggtttttgtct

PCR verification status

Line verified as correct.

No slide loaded.