| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT8890 | chr2L 17383657–17384144 (487 bp) | Lrch, CLIP-190 |
weak |
ventral ectoderm anlage | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | ventral ectoderm anlage | 1 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0032633 | Lrch | overlapping | BDGP FlyBase |
| FBgn0020503 | CLIP-190 | 1043bp upstream | BDGP FlyBase |
| FBgn0051804 | CG31804 | 19307bp downstream | BDGP FlyBase |
| FBgn0265446 | CR44346 | 22147bp downstream | BDGP FlyBase |
| FBgn0032634 | Rpb11 | 26041bp upstream | BDGP FlyBase |
Sequence
tattccagatcccgatcctgttccagatcctggaagggaagccgacccgctgccgatggcgctgccagcggcgctgccgacgccgactgcgacgctatgtaggcgttggtaaaccgttgctgccatttcccgtgtaggcgtggcgacacttccacacacttgcacacacacacgcacgcgctaaactatcacaccgataaggaaacggagtgaagtgccgaaagaaaccgaaactggaaactaaatttgctctattgaaacgcacgcatctcgattatttttcatttagtgtacgtcttcttggctcattgataagatttctcggaattggattttccttttgcggcttccttcttgcttcctcttctttgcctcctcgcacacacgcgcactcacacacgcacaagctcacgcagcagacgagcgacagtgcacaacgaaaatcgaaaaacaactgaatcggtttatgggatgctacttgggcagcg
PCR verification status
Line verified as correct.
No slide loaded.