ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT8890 | chr2L 17383657–17384144 (487 bp) | Lrch, CLIP-190 |
weak |
ventral ectoderm anlage | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | ventral ectoderm anlage | 1 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0032633 | Lrch | overlapping | BDGP FlyBase |
FBgn0020503 | CLIP-190 | 1043bp upstream | BDGP FlyBase |
FBgn0051804 | CG31804 | 19307bp downstream | BDGP FlyBase |
FBgn0265446 | CR44346 | 22147bp downstream | BDGP FlyBase |
FBgn0032634 | Rpb11 | 26041bp upstream | BDGP FlyBase |
Sequence
tattccagatcccgatcctgttccagatcctggaagggaagccgacccgctgccgatggcgctgccagcggcgctgccgacgccgactgcgacgctatgtaggcgttggtaaaccgttgctgccatttcccgtgtaggcgtggcgacacttccacacacttgcacacacacacgcacgcgctaaactatcacaccgataaggaaacggagtgaagtgccgaaagaaaccgaaactggaaactaaatttgctctattgaaacgcacgcatctcgattatttttcatttagtgtacgtcttcttggctcattgataagatttctcggaattggattttccttttgcggcttccttcttgcttcctcttctttgcctcctcgcacacacgcgcactcacacacgcacaagctcacgcagcagacgagcgacagtgcacaacgaaaatcgaaaaacaactgaatcggtttatgggatgctacttgggcagcg
PCR verification status
Line verified as correct.
No slide loaded.