| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT8920 | chr2L 17442110–17442820 (710 bp) | dl, CG33928 |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0260632 | dl | overlapping | BDGP FlyBase iFly |
| FBgn0053928 | CG33928 | 5511bp downstream | BDGP FlyBase |
| FBgn0032636 | CG5043 | 6311bp downstream | BDGP FlyBase |
| FBgn0011274 | Dif | 8950bp downstream | BDGP FlyBase iFly |
| FBgn0032637 | CG5050 | 10814bp upstream | BDGP FlyBase |
Sequence
agagcaggatgatctgggtgttgccgaaaacggtggccgagcagctacacagccggcagatgaccaggtcggacatggccttcttatcgaagatgggctccgaaactaccggcggcagtggcgaggtgaatcgacccttctgctcgctctccatgaatacttgaaagcacaatcgcaccgaattcagatctatgctcgagggctggaaacgatgcgaaaagccagctaaagaaagcaaatgcaaagggttaaactttaaggctaacaatttttgtgttgtacaagaccacctactcttaaacggatccacacggatctcctcgcgcgccttgagcgccgcctcaatgtccttctttttgacacactggatacccaagttactgaacaccgctcgcattgtctcactgttgatctccagtgtacagacgcccttcttgcagccctccttgccaactaaattgtggggatgaggactgaaatgggaaagggaacacaattatttaattattttatacctacatatatatgtatccttaactcaccgatatggcgtatcctttgtgacgcaggagacaacaactacggcgcgtcccttgtagcccacaatttcgattgtcggataggtcttgttctccggcgtagagttcacgcccggaatggatcccgccgagcgtccctcgcactcgtagcgaaaccttagcgcctttcctg
PCR verification status
Line verified as correct.
No slide loaded.