ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT8920 | chr2L 17442110–17442820 (710 bp) | dl, CG33928 |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0260632 | dl | overlapping | BDGP FlyBase iFly |
FBgn0053928 | CG33928 | 5511bp downstream | BDGP FlyBase |
FBgn0032636 | CG5043 | 6311bp downstream | BDGP FlyBase |
FBgn0011274 | Dif | 8950bp downstream | BDGP FlyBase iFly |
FBgn0032637 | CG5050 | 10814bp upstream | BDGP FlyBase |
Sequence
agagcaggatgatctgggtgttgccgaaaacggtggccgagcagctacacagccggcagatgaccaggtcggacatggccttcttatcgaagatgggctccgaaactaccggcggcagtggcgaggtgaatcgacccttctgctcgctctccatgaatacttgaaagcacaatcgcaccgaattcagatctatgctcgagggctggaaacgatgcgaaaagccagctaaagaaagcaaatgcaaagggttaaactttaaggctaacaatttttgtgttgtacaagaccacctactcttaaacggatccacacggatctcctcgcgcgccttgagcgccgcctcaatgtccttctttttgacacactggatacccaagttactgaacaccgctcgcattgtctcactgttgatctccagtgtacagacgcccttcttgcagccctccttgccaactaaattgtggggatgaggactgaaatgggaaagggaacacaattatttaattattttatacctacatatatatgtatccttaactcaccgatatggcgtatcctttgtgacgcaggagacaacaactacggcgcgtcccttgtagcccacaatttcgattgtcggataggtcttgttctccggcgtagagttcacgcccggaatggatcccgccgagcgtccctcgcactcgtagcgaaaccttagcgcctttcctg
PCR verification status
Line verified as correct.
No slide loaded.