ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT9636 | chr2L 18826432–18826811 (379 bp) | CG17323, CG17322 |
![]() ![]() ![]() ![]() ![]() ![]() active |
lateral epidermis subset | VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | lateral epidermis subset | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0032713 | CG17323 | overlapping | BDGP FlyBase |
FBgn0027070 | CG17322 | 338bp upstream | BDGP FlyBase |
FBgn0032715 | CG17597 | 2580bp upstream | BDGP FlyBase |
FBgn0027074 | CG17324 | 3860bp downstream | BDGP FlyBase |
FBgn0015808 | ScpX | 4797bp upstream | BDGP FlyBase |
Sequence
aatgttgtaatgaacaactgcaaggaacaacttatttttaaatgaatggaaatgaacatattagaagaaatataatatctgaaaattgtttctagtacggaaataaataaagtttttaaaatatttcactctttttcaatgccgtgcgcatcagtaatgttcaaatgctcggaaattcgtagatgaaattccctatgtatttatttctagccaagagcacttacatgttgcgatactttttaagttccccctaaaagattgaattatgtatgtgtgtatgtatgtaaatataagtatatgtatgctttcggcgcctaattgagcttttttactcgccggcgtcagttgatgctcatcttccgaccgttccggatctagct
PCR verification status
Line was not verified.
No slide loaded.