| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT9636 | chr2L 18826432–18826811 (379 bp) | CG17323, CG17322 |
      active |
lateral epidermis subset | VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | lateral epidermis subset | 2 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0032713 | CG17323 | overlapping | BDGP FlyBase |
| FBgn0027070 | CG17322 | 338bp upstream | BDGP FlyBase |
| FBgn0032715 | CG17597 | 2580bp upstream | BDGP FlyBase |
| FBgn0027074 | CG17324 | 3860bp downstream | BDGP FlyBase |
| FBgn0015808 | ScpX | 4797bp upstream | BDGP FlyBase |
UCSC snapshot
Sequence
aatgttgtaatgaacaactgcaaggaacaacttatttttaaatgaatggaaatgaacatattagaagaaatataatatctgaaaattgtttctagtacggaaataaataaagtttttaaaatatttcactctttttcaatgccgtgcgcatcagtaatgttcaaatgctcggaaattcgtagatgaaattccctatgtatttatttctagccaagagcacttacatgttgcgatactttttaagttccccctaaaagattgaattatgtatgtgtgtatgtatgtaaatataagtatatgtatgctttcggcgcctaattgagcttttttactcgccggcgtcagttgatgctcatcttccgaccgttccggatctagct
PCR verification status
Line was not verified.
No slide loaded.